Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249579

Morpholino Name: fuz MO1
Synonyms: xfy-MO
Target mRNA: fuz

Morpholino Type: uncategorized morpholino
Sequence: 5' ATCCACTTACTTACCGTAGGACTCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GGAGTCCTACGGTAAGTAAGTGGAT 3' ||||||||||||||||||||||||| 3' CCTCAGGATGCCATTCATTCACCTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr7L:106495519..106495543 25/25 Antisense target fuz.L
chr8S:39629987..39630011 21/25 unknown
Publications
First: Ciliogenesis defects in embryos lacking inturned or fuzzy function are associated with failure of planar cell polarity and Hedgehog signaling., Nat Genet 2006  
Most recent: The ciliopathy-associated CPLANE proteins direct basal body recruitment of intraflagellar transport machinery., Nat Genet 2016                                
View All Papers