Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249586

Morpholino Name: fzd7 MO1
Synonyms: Fz7, Fz7-MO, Fz7Mo, MoFz7, XFz7-MO, Xfz7 MO1
mRNA Target: fzd7

Morpholino Type: uncategorized morpholino
Sequence:
5' CCAACAAGTGATCTCTGGACAGCAG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CTGCTGTCCAGAGATCACTTGTTGG 3' ||||||||||||||||||||||||| 3' GACGACAGGTCTCTAGTGAACAACC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold139113:826163..826187 25/25 Antisense target fzd7.L
tropicalis 7.1 scaffold_8:58413945..58413969 23/25 unknown
Publications
First: Frizzled-7 signalling controls tissue separation during Xenopus gastrulation., Nature 2001  
Most recent: Secreted Frizzled-related Protein 2 (sFRP2) Redirects Non-canonical Wnt Signaling from Fz7 to Ror2 during Vertebrate Gastrulation., J Biol Chem 2016                
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556