Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249587

Morpholino Name: fzd7 MO2
Synonyms: Xfz7 MO2
mRNA Target: fzd7

Morpholino Type: uncategorized morpholino
Sequence:
5' GCGGAGTGAGCAGAAATCGGCTGA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/24
genomic

MO
5' TCAGCCGATTTCTGCTCACTCCGC 3' |||||||||||||||||||||||| 3' AGTCGGCTAAAGACGAGTGAGGCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr9_10S:72104771..72104794 24/24 Antisense target fzd7.S
Publications
First: Frizzled7 mediates canonical Wnt signaling in neural crest induction., Dev Biol 2006                        
Most recent: Frizzled-7 is required for Xenopus heart development., Biol Open 2017              
View All Papers