Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249588

Morpholino Name: fzd7 MO3
Synonyms: Xfz7 MO3, Xfz7MO
mRNA Target: fzd7

Morpholino Type: uncategorized morpholino
Sequence:
5' CCGGCTCCAACAAGTGATCTCTGG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/24
genomic

MO
5' CCAGAGATCACTTGTTGGAGCCGG 3' |||||||||||||||||||||||| 3' GGTCTCTAGTGAACAACCTCGGCC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr9_10L:79371461..79371484 24/24 Antisense target fzd7.L
chr5S:134370591..134370614 20/24 Sense off-target LOC108717514 [provisional:vmn2r26]
chr7S:68139867..68139890 20/24 unknown
Publications
First: Xenopus frizzled-7 morphant displays defects in dorsoventral patterning and convergent extension movements during gastrulation., Genesis 2001    
Most recent: Syndecan4 coordinates Wnt/JNK and BMP signaling to regulate foregut progenitor development., Dev Biol 2016                                    
View All Papers