Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249589

Morpholino Name: fzd8 MO1
Synonyms: (Fzd-8)-Mo
mRNA Target: fzd8

Morpholino Type: uncategorized morpholino
Sequence:
5' GCAGCGACAGCGACAGACTCTCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATGGAGAGTCTGTCGCTGTCGCTGC 3' ||||||||||||||||||||||||| 3' TACCTCTCAGACAGCGACAGCGACG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6L:17741354..17741378 25/25 Antisense target fzd8.L
chr4S:104335272..104335296 21/25 Antisense off-target Xelaev18025856m
chr3S:66177602..66177626 21/25 unknown
chr5L:60915133..60915157 21/25 unknown
Publications
First: Inversin relays Frizzled-8 signals to promote proximal pronephros development., Proc Natl Acad Sci U S A 2010        
Most recent:
View All Papers