Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249590

Morpholino Name: fzd8 MO2
Synonyms: Fz8
Target mRNA: fzd8

Morpholino Type: uncategorized morpholino
Sequence: 5' GTCACTGTCTGAGGCTCATTCCTGG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25
genomic

MO
5' CCAGGAATGAGCCTCAGACAGTGAC 3' ||||||||||||||||||||||||| 3' GGTCCTTACTCGGAGTCTGTCACTG 5' 5' CCAGGAATGAGCCGCAGTCAGTGAC 3' ||||||||||||| ||| ||||||| 3' GGTCCTTACTCGGAGTCTGTCACTG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6L:17741298..17741322 25/25 Antisense target fzd8.L
chr6S:14567295..14567319 23/25 Antisense target fzd8.S
chr7L:73035100..73035124 21/25 Sense off-target nectin1.L
chr7S:52537410..52537434 21/25 Sense off-target pvrl1-like.2.S
chr3S:11845..11869 21/25 unknown
Publications
First: Frodo interacts with Dishevelled to transduce Wnt signals., Nat Cell Biol 2002  
Most recent: Roles of two types of heparan sulfate clusters in Wnt distribution and signaling in Xenopus., Nat Commun 2017                                                    
View All Papers