Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249591

Morpholino Name: fzd8 MO3
Synonyms: Xfz8 -Mo
Target mRNA: fzd8

Morpholino Type: uncategorized morpholino
Sequence: 5' GCAGCGACAGATACGGACACTCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATGGAGTGTCCGTATCTGTCGCTGC 3' ||||||||||||||||||||||||| 3' TACCTCACAGGCATAGACAGCGACG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6S:14567331..14567355 25/25 Antisense target fzd8.S
chr2S:27509593..27509617 22/25 unknown
tropicalis 10.0 Chr9:87146739..87146763 22/25 unknown
Publications
First: The role of Xenopus frizzled-8 in pronephric development., Biochem Biophys Res Commun 2004            
Most recent: Roles of two types of heparan sulfate clusters in Wnt distribution and signaling in Xenopus., Nat Commun 2017                                                    
View All Papers