Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249592

Morpholino Name: gabrg2 MO1
Synonyms: gamma2-MO
mRNA Target: gabrg2

Morpholino Type:
Sequence:
5' GATCGCATCTCTCGTCGCGTTTCGA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold15893:2251218-2251242 25/25 Antisense off-target Xelaev16016772m
Publications
First: Nde1-mediated inhibition of ciliogenesis affects cell cycle re-entry. [Nat Cell Biol 2011]
Most recent: Inhibition to excitation ratio regulates visual system responses and behavior in vivo. [J Neurophysiol 2011]
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556