Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249593

Morpholino Name: gad1.1 MO1
Synonyms: GAD67
mRNA Target: gad1.1

Morpholino Type:
Sequence:
5' GCAGGGTGTTCTCTTTCCTAAGCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 25/25
genomic

MO
5' ATGCTCAGGAAAGAGAATACCCTGC 3' ||||| ||||||||||| ||||||| 3' TACGAATCCTTTCTCTTGTGGGACG 5' 5' ATGCTTAGGAAAGAGAACACCCTGC 3' ||||||||||||||||||||||||| 3' TACGAATCCTTTCTCTTGTGGGACG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold43242:6730286-6730310 25/25 Antisense target gad1.1.L
tropicalis 7.1 scaffold_9:17853115-17853139 23/25 Antisense target gad1.1
Publications
First: Embryonically expressed GABA and glutamate drive electrical activity regulating neurotransmitter specification. [J Neurosci 2008]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556