Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249594

Morpholino Name: gad2 MO1
Synonyms: GAD65
mRNA Target: gad2

Morpholino Type: uncategorized morpholino
Sequence:
5' AAAACCCCGAGCCAGGAGACGCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25
genomic

MO
5' ATGGCTTCTCCTGGCTCCGGATTTT 3' ||||| ||||||||||| || |||| 3' TACCGCAGAGGACCGAGCCCCAAAA 5'
Genomic Alignments Position Identity Strand Target mRNA
tropicalis 7.1 scaffold_6:120172881..120172905 22/25 Antisense target gad2
Publications
First: Embryonically expressed GABA and glutamate drive electrical activity regulating neurotransmitter specification., J Neurosci 2008                
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556