Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249595

Morpholino Name: gadd45a MO1
Synonyms: Gadd45a, Gadd45a MO
mRNA Target: gadd45a

Morpholino Type:
Sequence:
5' GCTGCTCCTCCAGAGTCATATTATA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' TATAATATGACTCTGGAGGAGCAGC 3' ||||||||||||||||||||||||| 3' ATATTATACTGAGACCTCCTCGTCG 5' 5' TATAATATGACTCTGGAGGAGCAGC 3' ||||||||||||||||||||||||| 3' ATATTATACTGAGACCTCCTCGTCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold275988:436781-436805 25/25 Antisense target gadd45a.S
Scaffold155039:409508-409532 23/25 Antisense off-target Xelaev16016033m
Scaffold314296:1403757-1403781 23/25 unknown
tropicalis 7.1 scaffold_4:93458247-93458271 25/25 Antisense target gadd45a
Publications
First: Gadd45a and Gadd45g regulate neural development and exit from pluripotency in Xenopus. [Mech Dev 2011]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556