Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249595

Morpholino Name: gadd45a MO1
Synonyms: Gadd45a, Gadd45a MO
Target mRNA: gadd45a

Morpholino Type: uncategorized morpholino
Sequence: 5' GCTGCTCCTCCAGAGTCATATTATA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25 25/25
genomic

MO
5' TATAATATGACTCTGGAGGAGCAGC 3' ||||||||||||||||||||||||| 3' ATATTATACTGAGACCTCCTCGTCG 5' 5' TATAATATGACTCTGGAGGATCAAC 3' |||||||||||||||||||| || | 3' ATATTATACTGAGACCTCCTCGTCG 5' 5' TATAATATGACTCTGGAGGAGCAGC 3' ||||||||||||||||||||||||| 3' ATATTATACTGAGACCTCCTCGTCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr4S:58068601..58068625 25/25 Antisense target gadd45a.S
chr4L:72907386..72907410 23/25 Antisense target gadd45a.L
chr2L:95156607..95156631 23/25 unknown
tropicalis 10.0 Chr4:83506301..83506325 25/25 Antisense target gadd45a
Publications
First: Gadd45a and Gadd45g regulate neural development and exit from pluripotency in Xenopus., Mech Dev 2011                        
Most recent:
View All Papers