Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249596

Morpholino Name: gadd45b MO1
Synonyms: Gadd45b-1, Gadd45b-1 MO
mRNA Target: gadd45b

Morpholino Type:
Sequence:
5' AATCTTCCAGAATCAGCGTAAATCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold54274:1658268..1658292 25/25 Antisense off-target Xelaev16061775m
Scaffold39437:2945092..2945116 21/25 Antisense off-target Xelaev16050093m
Publications
First: Gadd45a and Gadd45g regulate neural development and exit from pluripotency in Xenopus. [Mech Dev 2011]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.8.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556