Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249597

Morpholino Name: gadd45b MO2
Synonyms: Gadd45b-2, Gadd45b-2 MO
mRNA Target: gadd45b

Morpholino Type:
Sequence:
5' AAAGTCATACTGTTGCAGCAACTCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' AGACTTGCTGCAACAGTATGACTTT 3' ||| ||||||||||||||||||||| 3' TCTCAACGACGTTGTCATACTGAAA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold54274:1658313-1658337 25/25 Antisense off-target Xelaev16061775m
Scaffold39437:2945050-2945074 24/25 Antisense off-target Xelaev16050093m
Scaffold277614:2537454-2537478 21/25 unknown
Scaffold45985:2258886-2258910 21/25 unknown
Scaffold51452:3021726-3021750 21/25 unknown
Scaffold60618:616217-616241 21/25 unknown
Scaffold9266:11357047-11357071 21/25 unknown
tropicalis 7.1 scaffold_1:136665573-136665597 24/25 Antisense target gadd45b
scaffold_5:70578493-70578517 21/25 Sense off-target adss
scaffold_6:53894065-53894089 21/25 unknown
scaffold_7:20642060-20642084 21/25 unknown
Publications
First: Gadd45a and Gadd45g regulate neural development and exit from pluripotency in Xenopus. [Mech Dev 2011]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556