Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249598

Morpholino Name: gadd45g MO1
Synonyms: Gadd45g, Gadd45g MO
mRNA Target: gadd45g

Morpholino Type:
Sequence:
5' TCCGTGAACTTCTTCCAGAGTCATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' CATGACTCTGGAAGAAGTTCACGGA 3' ||||||||||||||||||||||||| 3' GTACTGAGACCTTCTTCAAGTGCCT 5' 5' CATGACTCTGGAAGAAGTTCACGGA 3' ||||||||||||||||||||||||| 3' GTACTGAGACCTTCTTCAAGTGCCT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold12020:14409789..14409813 25/25 Antisense off-target Xelaev16005459m
Scaffold13576:4105187..4105211 25/25 Antisense target gadd45g.L
tropicalis 7.1 scaffold_1:87642386..87642410 25/25 Antisense target gadd45g
Publications
First: Gadd45a and Gadd45g regulate neural development and exit from pluripotency in Xenopus. [Mech Dev 2011]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.2
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556