Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249599

Morpholino Name: gadd45g MO2
Synonyms: XGadd45-g
mRNA Target: gadd45g

Morpholino Type:
Sequence:
5' GTCCGTGAACTTCTTCCAGAGTAGTCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/28 25/28
genomic

MO
5' ATCATGACTCTGGAAGAAGTTCACGGAC 3' || | |||||||||||||||||||||| 3' TACTGATGAGACCTTCTTCAAGTGCCTG 5' 5' ATCATGACTCTGGAAGAAGTTCACGGAC 3' || | |||||||||||||||||||||| 3' TACTGATGAGACCTTCTTCAAGTGCCTG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold13576:4105185-4105212 25/28 Antisense target gadd45g.L
Scaffold12020:14409788-14409815 24/28 Antisense off-target Xelaev16005459m
tropicalis 7.1 scaffold_1:87642385-87642412 25/28 Antisense target gadd45g
Publications
First: Xiro homeoproteins coordinate cell cycle exit and primary neuron formation by upregulating neuronal-fate repressors and downregulating the cell-cycle inhibitor XGadd45-gamma. [Mech Dev 2002]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556