Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249601

Morpholino Name: galntl1 MO1
Synonyms: xGalntl-1 morpholino
mRNA Target: galnt16

Morpholino Type:
Sequence:
5' AAGCCTTCAGCTCTTTCCCATTCTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' GAGAATGGGAAAGAGCTGAAGGCTT 3' ||||||||||||||||||||||||| 3' CTCTTACCCTTTCTCGACTTCCGAA 5' 5' GAGAATGGGAAAGAGCTGAAGGCTT 3' ||||||||||||||||||||||||| 3' CTCTTACCCTTTCTCGACTTCCGAA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold265107:1796444-1796468 25/25 Antisense target galnt16.L
Scaffold373399:1607075-1607099 22/25 unknown
Scaffold32791:644109-644133 21/25 unknown
Scaffold74548:333660-333684 21/25 unknown
Scaffold86871:2705446-2705470 21/25 Sense off-target Xelaev16076699m
tropicalis 7.1 scaffold_8:85665836-85665860 25/25 Antisense target galnt16
scaffold_8:40236098-40236122 22/25 unknown
scaffold_1:44744597-44744621 21/25 Antisense off-target cux2
Publications
First: Regulation of TGF-(beta) signalling by N-acetylgalactosaminyltransferase-like 1. [Development 2008]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556