Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249602

Morpholino Name: galntl1 MO2
Synonyms: xGalntl-1 morpholino
mRNA Target: galnt16

Morpholino Type: uncategorized morpholino
Sequence:
5' CTGATCCTTCTCATGCTGCCGGTAG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 25/25
genomic

MO
5' CTGCCGGCAGCATGAGAAGGATCCG 3' || |||||||||||||||||||| | 3' GATGGCCGTCGTACTCTTCCTAGTC 5' 5' CTACCGGCAGCATGAGAAGGATCAG 3' ||||||||||||||||||||||||| 3' GATGGCCGTCGTACTCTTCCTAGTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold265107:1796501..1796525 25/25 Antisense target galnt16.L
Scaffold102262:1129344..1129368 21/25 unknown
tropicalis 7.1 scaffold_8:85665779..85665803 23/25 Antisense target galnt16
Publications
First: Regulation of TGF-(beta) signalling by N-acetylgalactosaminyltransferase-like 1., Development 2008                      
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556