Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249606

Morpholino Name: gata4 MO1
Synonyms: G4MO
mRNA Target: gata4

Morpholino Type: uncategorized morpholino
Sequence:
5' CCTCATAGCCAGAGGGACCATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 21/22 22/22
genomic

MO
5' CATGGTCCCCCTGGCTATGAGG 3' ||||||||| |||||||||||| 3' GTACCAGGGAGACCGATACTCC 5' 5' CATGGTCCCTCTGGCTATGAGG 3' |||||||||||||||||||||| 3' GTACCAGGGAGACCGATACTCC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5S:130398847..130398868 22/22 Antisense target gata4.S
chr5L:151179420..151179441 21/22 Antisense target gata4.L
chr6S:37941991..37942012 20/22 Sense off-target ube2e2.S
chr3L:96786126..96786147 18/22 unknown
tropicalis 10.0 Chr6:72158651..72158672 19/22 Antisense off-target slc9a3
Publications
First: GATA4 and GATA5 are essential for heart and liver development in Xenopus embryos., BMC Dev Biol 2008                          
Most recent:
View All Papers