Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249607

Morpholino Name: gata4 MO2
Synonyms: GATA4 MO, gata4
mRNA Target: gata4

Morpholino Type: uncategorized morpholino
Sequence:
5' CTGGCAACTCAATCCACAAAATCCA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 21/25 25/25
genomic

MO
5' TCGGATCTGTGGATTGAGTTGCCAG 3' | | | |||||||||||||||||| 3' ACCTAAAACACCTAACTCAACGGTC 5' 5' TGGATTTTGTGGATTGAGTTGCCAG 3' ||||||||||||||||||||||||| 3' ACCTAAAACACCTAACTCAACGGTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold7103:2059849..2059873 25/25 Antisense target gata4.S
Scaffold678:201319..201343 21/25 Antisense target gata4.L
Publications
First: Redundancy and evolution of GATA factor requirements in development of the myocardium., Dev Biol 2007            
Most recent: sfrp1 promotes cardiomyocyte differentiation in Xenopus via negative-feedback regulation of Wnt signalling., Development 2013                                      
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556