Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249609

Morpholino Name: gata4 MO4
Synonyms: G4SP MO, GATA4 sp
mRNA Target: gata4

Morpholino Type: uncategorized morpholino
Sequence:
5' ATGCAGACTAAAGAGACAAGATATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CATATCTTGTCTCTTTAGTCTGCAT 3' ||||||||||||||||||||||||| 3' GTATAGAACAGAGAAATCAGACGTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold179492:1596763..1596787 21/25 unknown
tropicalis 7.1 scaffold_5b:1556510..1556534 25/25 Antisense target gata4
Publications
First: GATA4 and GATA5 are essential for heart and liver development in Xenopus embryos., BMC Dev Biol 2008                          
Most recent: Genome-wide transcriptomics analysis of genes regulated by GATA4, 5 and 6 during cardiomyogenesis in Xenopus laevis., Data Brief 2018    
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556