Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249611

Morpholino Name: gata5 MO2
Synonyms: G5UTR MO
mRNA Target: gata5

Morpholino Type: uncategorized morpholino
Sequence:
5' GCTACAAACCTCACAGCTCCGGCTG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' CAGCAGGAGCTGTGAGGTTTGTAGC 3' |||| |||||||||||||||||||| 3' GTCGGCCTCGACACTCCAAACATCG 5' 5' CAGCCGGAGCTGTGAGGTTTGTAGC 3' ||||||||||||||||||||||||| 3' GTCGGCCTCGACACTCCAAACATCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold14557:1117243..1117267 25/25 Antisense target gata5.S
Scaffold13471:2972664..2972688 24/25 Antisense target gata5.L
Publications
First: GATA4 and GATA5 are essential for heart and liver development in Xenopus embryos., BMC Dev Biol 2008                          
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556