Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249612

Morpholino Name: gata5 MO3
Synonyms: GATA5 MO
Target mRNA: gata5

Morpholino Type: uncategorized morpholino
Sequence: 5' GCTACAAACCTCACAGCTCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 20/20 20/20
genomic

MO
5' GGAGCTGTGAGGTTTGTAGC 3' |||||||||||||||||||| 3' CCTCGACACTCCAAACATCG 5' 5' GGAGCTGTGAGGTTTGTAGC 3' |||||||||||||||||||| 3' CCTCGACACTCCAAACATCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr9_10L:14518882..14518901 20/20 Antisense target gata5.L
chr9_10S:13136654..13136673 20/20 Antisense target gata5.S
chr9_10L:14518882..14518901 20/20 Sense off-target LOC108700924
chr1S:75217486..75217505 18/20 Antisense off-target adgrl3.S
chr4S:20550764..20550783 16/20 Antisense off-target nav2.S
chr6L:117009868..117009887 16/20 Antisense off-target fam110b.L
chr2L:36924827..36924846 16/20 unknown
chr2S:1504809..1504828 16/20 unknown
chr5S:92328095..92328114 16/20 unknown
tropicalis 10.0 Chr8:146586964..146586983 17/20 Antisense off-target gon4l
Chr8:70700734..70700753 16/20 Antisense off-target LOC100485719
Chr9:88582931..88582950 16/20 Antisense off-target eaf2
Publications
First: GATA4, 5 and 6 mediate TGFbeta maintenance of endodermal gene expression in Xenopus embryos., Development 2005            
Most recent: sfrp1 promotes cardiomyocyte differentiation in Xenopus via negative-feedback regulation of Wnt signalling., Development 2013                                      
View All Papers