Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249616

Morpholino Name: gbx2.1 MO1
Synonyms: GBX2 ATG MO, Gbx2 ATG, Gbx2 MO
Target mRNA: gbx2.1

Morpholino Type: uncategorized morpholino
Sequence: 5' GCTGAAAGGCTGCACTCATATAAGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' GCTTATATGAGTGCAGCCTTTCAGC 3' ||||||||||||||||||||||||| 3' CGAATATACTCACGTCGGAAAGTCG 5' 5' GCTTATATGAGTGCAGCCTTTCAGC 3' ||||||||||||||||||||||||| 3' CGAATATACTCACGTCGGAAAGTCG 5' 5' GCTTATATGAGTGCAGCCTTTCAGC 3' ||||||||||||||||||||||||| 3' CGAATATACTCACGTCGGAAAGTCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr9_10L:72718731..72718755 25/25 Antisense target gbx2.1.L
chr9_10S:66538357..66538381 25/25 Antisense target gbx2.1.S
chr9_10L:72707712..72707736 25/25 Antisense off-target gbx2.2.L
chr9_10S:66532881..66532905 24/25 Antisense off-target gbx2.2.S
chr4S:106929219..106929243 21/25 Antisense off-target plxna1.S
Scaffold69584:12..36 25/25 unknown
tropicalis 10.0 Chr9:59828205..59828229 25/25 Antisense target gbx2.1
Chr9:59835495..59835519 25/25 Antisense off-target gbx2.2
Chr1:160653494..160653518 21/25 unknown
Publications
First: The posteriorizing gene Gbx2 is a direct target of Wnt signalling and the earliest factor in neural crest induction., Development 2009              
Most recent: Mutual repression between Gbx2 and Otx2 in sensory placodes reveals a general mechanism for ectodermal patterning., Dev Biol 2012                  
View All Papers