Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249617

Morpholino Name: gdf1 MO1
Synonyms: Vg1MO
Target mRNA: gdf1

Morpholino Type: uncategorized morpholino
Sequence: 5' CCACAGTCTCAGCCACACCATACTG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25 24/25 23/25
genomic

MO
5' CAGCATGGTGTGGCTCAGGCTGTGG 3' ||| ||||||||||| || |||||| 3' GTCATACCACACCGACTCTGACACC 5' 5' CAGTATGATGTGGCTGAGACTGTGG 3' ||||||| ||||||||||||||||| 3' GTCATACCACACCGACTCTGACACC 5' 5' TAATATGGTGTGGCTGAGACTGTGG 3' | |||||||||||||||||||||| 3' GTCATACCACACCGACTCTGACACC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1L:112281239..112281263 24/25 Antisense target gdf1.L
Scaffold21:243750..243774 23/25 Antisense target gdf1.S
chr5L:118377677..118377701 21/25 unknown
chr5S:101643616..101643640 21/25 unknown
chr3S:44741851..44741875 21/25 unknown
tropicalis 10.0 Chr1:112587892..112587916 22/25 Antisense target gdf1
Chr1:112587892..112587916 22/25 Sense off-target ddx49
Chr3:146999628..146999652 21/25 Sense off-target kdm6b
Publications
First: Vg 1 is an essential signaling molecule in Xenopus development., Development 2006      
Most recent:
View All Papers