Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249618

Morpholino Name: gdf10 MO1
Synonyms: xBMP-3b MO
mRNA Target: gdf10

Morpholino Type: uncategorized morpholino
Sequence:
5' AAGACATAACTAGAGAGAATTGCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATGCAATTCTCTCTAGTTATGTCTT 3' ||||||||||||||||||||||||| 3' TACGTTAAGAGAGATCAATACAGAA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold27067:2618578..2618602 25/25 Antisense target gdf10.L
Scaffold247724:3195349..3195373 21/25 unknown
tropicalis 7.1 scaffold_1:9683513..9683537 21/25 Sense off-target gzma
scaffold_3b:1175087..1175111 21/25 unknown
Publications
First: Coordination of BMP-3b and cerberus is required for head formation of Xenopus embryos., Dev Biol 2003                              
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.3


Major funding for Xenbase is provided by grant P41 HD064556