Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249622

Morpholino Name: gdf3 MO1
Synonyms: Der MO
mRNA Target: gdf3

Morpholino Type: uncategorized morpholino
Sequence:
5' CACAACTCTGCCATGTTGACTTCTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GAGAAGTCAACATGGCAGAGTTGTG 3' ||||||||||||||||||||||||| 3' CTCTTCAGTTGTACCGTCTCAACAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold357348:409901..409925 25/25 Antisense target gdf3.S
tropicalis 7.1 scaffold_2:39185996..39186020 21/25 unknown
Publications
First: The left-right axis is regulated by the interplay of Coco, Xnr1 and derrière in Xenopus embryos., Dev Biol 2007                
Most recent: TGF-β Signaling Regulates the Differentiation of Motile Cilia., Cell Rep 2015                  
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.1


Major funding for Xenbase is provided by grant P41 HD064556