Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249629

Morpholino Name: gipc2 MO1
Synonyms: K2M, Kermit 2 morpholino, gipc2, kermit2, kermit2 MO
mRNA Target: gipc2

Morpholino Type: uncategorized morpholino
Sequence:
5' AGAGGCATCTTTCTTTCAGCGAAGG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' TCTTCGCTGAAAGAAAGATGCCTCT 3' |||||||||||||||||||||||| 3' GGAAGCGACTTTCTTTCTACGGAGA 5' 5' CCTTCGCTGAAAGAAAGATGCCTCT 3' ||||||||||||||||||||||||| 3' GGAAGCGACTTTCTTTCTACGGAGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold15038:2213041..2213065 25/25 Antisense off-target Xelaev16014787m
Scaffold24235:4235754..4235778 25/25 Antisense target gipc2.S
Scaffold137317:2755887..2755911 22/25 unknown
Scaffold84760:271..295 22/25 unknown
Scaffold16001:5820870..5820894 21/25 unknown
Scaffold31653:6601090..6601114 21/25 unknown
Scaffold409592:7001..7025 21/25 Antisense off-target pef1.L
tropicalis 7.1 scaffold_4:90097106..90097130 24/25 Antisense target gipc2
scaffold_7:103741731..103741755 21/25 unknown
Publications
First: Kermit 2/XGIPC, an IGF1 receptor interacting protein, is required for IGF signaling in Xenopus eye development., Development 2006            
Most recent: Eukaryotic initiation factor eIF6 modulates the expression of Kermit 2/XGIPC in IGF- regulated eye development., Dev Biol 2017          
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556