Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249630

Morpholino Name: git2 MO1
Synonyms: xGit2
mRNA Target: git2

Morpholino Type: uncategorized morpholino
Sequence:
5' GCTCCTCAGCCGCTTGGACATGGTA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' CACCATGTCCAAGCGGCTGAGGAGC 3' |||||||||||||||||||||||| 3' ATGGTACAGGTTCGCCGACTCCTCG 5' 5' TACCATGTCCAAGCGGCTGAGGAGC 3' ||||||||||||||||||||||||| 3' ATGGTACAGGTTCGCCGACTCCTCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold143664:849183..849207 25/25 Antisense target git2.L
Scaffold44061:2443450..2443474 25/25 Antisense off-target Xelaev16054400m
tropicalis 7.1 scaffold_1:60519917..60519941 24/25 Antisense target git2
Publications
First: xGit2 and xRhoGAP 11A regulate convergent extension and tissue separation in Xenopus gastrulation., Dev Biol 2010            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556