Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249631

Morpholino Name: gli1 MO1
Synonyms: Gli3 MO1, gli1
mRNA Target: gli1

Morpholino Type: uncategorized morpholino
Sequence:
5' CGGGCGGACACTGGCGGGACGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 20/22 22/22
genomic

MO
5' GCGTCCCGCCAGTGTCCACCAG 3' ||||||||||||||||| || | 3' CGCAGGGCGGTCACAGGCGGGC 5' 5' GCGTCCCGCCAGTGTCCGCCCG 3' |||||||||||||||||||||| 3' CGCAGGGCGGTCACAGGCGGGC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold5732:1214390..1214411 22/22 Antisense target gli1.S
Scaffold70222:1334696..1334717 22/22 Antisense off-target Xelaev16069245m
Scaffold12462:2312203..2312224 18/22 unknown
Scaffold127590:212170..212191 18/22 Antisense off-target Xelaev16007843m
tropicalis 7.1 scaffold_2:84470241..84470262 20/22 Antisense target gli1
scaffold_8:28792191..28792212 18/22 unknown
Publications
First: Cooperative requirement of the Gli proteins in neurogenesis., Development 2005                        
Most recent: Members of the Rusc protein family interact with Sufu and inhibit vertebrate Hedgehog signaling., Development 2016                          
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556