Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249632

Morpholino Name: gli2 MO1
Synonyms: Gli3 MO2, gli2
mRNA Target: gli2

Morpholino Type: uncategorized morpholino
Sequence:
5' GCACAGAACGCAGGTAATGCTCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 25/25
genomic

MO
5' ATGGAGCATTACCTGCGCTCCGTGC 3' ||||||||||||||||| || |||| 3' TACCTCGTAATGGACGCAAGACACG 5' 5' ATGGAGCATTACCTGCGTTCTGTGC 3' ||||||||||||||||||||||||| 3' TACCTCGTAATGGACGCAAGACACG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold163806:6718292..6718316 25/25 Antisense target gli2.S
Scaffold84188:2248758..2248782 25/25 Antisense off-target Xelaev16075844m
Scaffold115919:617660..617684 21/25 Antisense off-target Xelaev16004376m
Scaffold159815:809363..809387 21/25 unknown
tropicalis 7.1 scaffold_385:53872..53896 23/25 Antisense target gli2
Publications
First: Cooperative requirement of the Gli proteins in neurogenesis., Development 2005                        
Most recent: A Retinoic Acid-Hedgehog Cascade Coordinates Mesoderm-Inducing Signals and Endoderm Competence during Lung Specification., Cell Rep 2016                                                
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556