Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249634

Morpholino Name: gli3 MO2
Synonyms: Gli3 MO
mRNA Target: gli3

Morpholino Type: uncategorized morpholino
Sequence:
5' AGTGCTACGGGACTGGGCTTCCATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' CATGGAAGCCCAGTCCCGTAGCACT 3' ||||||||||||||||||||||||| 3' GTACCTTCGGGTCAGGGCATCGTGA 5' 5' CATGGAAGCCCAGTCCCGTAGCACT 3' ||||||||||||||||||||||||| 3' GTACCTTCGGGTCAGGGCATCGTGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold1301:391868..391892 25/25 Antisense off-target Xelaev16008594m
Scaffold5228:2839466..2839490 25/25 Antisense target gli3.L
tropicalis 7.1 scaffold_6:85834418..85834442 25/25 Antisense target gli3
Publications
First: Antagonistic cross-regulation between Wnt and Hedgehog signalling pathways controls post-embryonic retinal proliferation., Development 2012                      
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556