Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249635

Morpholino Name: gmnc MO1
Synonyms: xGEMC1.1
mRNA Target: gmnc

Morpholino Type: uncategorized morpholino
Sequence:
5' CTTGGCAAGTTAGAATAGTGTTCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25
genomic

MO
5' CAGAACACTATTCTAACTTGCCAAG 3' ||||||||||||||||||||||| 3' TACTTGTGATAAGATTGAACGGTTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold45774:867842..867866 23/25 Antisense target gmnc.S
Scaffold30987:4857515..4857539 22/25 Antisense off-target Xelaev16041767m
Scaffold176467:727008..727032 21/25 unknown
tropicalis 7.1 scaffold_1:198262565..198262589 21/25 unknown
scaffold_7:69850788..69850812 21/25 Sense off-target mcam
scaffold_8:46107615..46107639 21/25 Antisense off-target mbnl3
Publications
First: GEMC1 is a TopBP1-interacting protein required for chromosomal DNA replication., Nat Cell Biol 2010          
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556