Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249635

Morpholino Name: gmnc MO1
Synonyms: xGEMC1.1
mRNA Target: gmnc

Morpholino Type: uncategorized morpholino
Sequence:
5' CTTGGCAAGTTAGAATAGTGTTCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25 23/25
genomic

MO
5' CAGAACACTATTCTGACTTGCCAAG 3' |||||||||||| |||||||||| 3' TACTTGTGATAAGATTGAACGGTTC 5' 5' CAGAACACTATTCTAACTTGCCAAG 3' ||||||||||||||||||||||| 3' TACTTGTGATAAGATTGAACGGTTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5S:83952052..83952076 23/25 Antisense target gmnc.S
chr5L:100716608..100716632 22/25 Antisense target gmnc.L
Scaffold43:731612..731636 21/25 unknown
tropicalis 10.0 Chr1:21873144..21873168 21/25 unknown
Chr7:80256650..80256674 21/25 Sense off-target mcam
Chr8:67520018..67520042 21/25 Antisense off-target mbnl3
Publications
First: GEMC1 is a TopBP1-interacting protein required for chromosomal DNA replication., Nat Cell Biol 2010          
Most recent:
View All Papers