Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249636

Morpholino Name: gmnc MO2
Synonyms: xGEMC1.2
mRNA Target: gmnc

Morpholino Type: uncategorized morpholino
Sequence:
5' GTTCCTGGCAGGCAGGCACCTTTTCATTG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
Publications
First: GEMC1 is a TopBP1-interacting protein required for chromosomal DNA replication., Nat Cell Biol 2010          
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556