Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249637

Morpholino Name: gmnn MO1
Synonyms: Geminin H, Geminin antisense morpholino, GemininMO, antigeminin H, antigeminin H oligonucleotide, gemMO, geminin
mRNA Target: gmnn

Morpholino Type: uncategorized morpholino
Sequence:
5' ATCTCTGCTTCTTGTTGGTATTCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 25/25
genomic

MO
5' ATGAATACCAACATGAAGCAGCGAT 3' ||||||||||||| ||||||| ||| 3' TACTTATGGTTGTTCTTCGTCTCTA 5' 5' ATGAATACCAACAAGAAGCAGAGAT 3' ||||||||||||||||||||||||| 3' TACTTATGGTTGTTCTTCGTCTCTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold23301:6338102..6338126 25/25 Antisense target gmnn.S
Scaffold73623:106852..106876 23/25 Antisense off-target Xelaev16070695m
Scaffold139741:74791..74815 21/25 Sense off-target tnfrsf10b.S
tropicalis 7.1 scaffold_6:52044495..52044519 23/25 Antisense target gmnn
scaffold_2:15296924..15296948 21/25 unknown
Publications
First: Geminin deficiency causes a Chk1-dependent G2 arrest in Xenopus., Mol Biol Cell 2002              
Most recent: Geminin is required for zygotic gene expression at the Xenopus mid-blastula transition., PLoS One 2012                          
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556