Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249638

Morpholino Name: gmnn MO2
Synonyms: GemMO, antigeminin L oligonucleotide, geminin, geminin L
mRNA Target: gmnn

Morpholino Type: uncategorized morpholino
Sequence:
5' TAAGCCTCTGCTCTTTTCACGCACA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 21/25
genomic

MO
5' TGTGCGTGAAAAGAGCAGAGGTGAG 3' ||||||||||||||||||||| 3' ACACGCACTTTTCTCGTCTCCGAAT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1S:48333740..48333764 21/25 Sense off-target LOC108704365 [provisional:inpp4b]
chr6L:95001275..95001299 21/25 Antisense target gmnn.L
chr6S:63478097..63478121 21/25 unknown
chr9_10L:92331318..92331342 21/25 Antisense off-target xylt1.L
Publications
First: Geminin deficiency causes a Chk1-dependent G2 arrest in Xenopus., Mol Biol Cell 2002              
Most recent: Geminin is required for zygotic gene expression at the Xenopus mid-blastula transition., PLoS One 2012                          
View All Papers