Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249638

Morpholino Name: gmnn MO2
Synonyms: GemMO, antigeminin L oligonucleotide, geminin, geminin L
mRNA Target: gmnn

Morpholino Type: uncategorized morpholino
Sequence:
5' TAAGCCTCTGCTCTTTTCACGCACA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold57094:85976..86000 21/25 unknown
Scaffold73623:105171..105195 21/25 Antisense off-target Xelaev16070695m
Scaffold99286:5592803..5592827 21/25 Sense off-target Xelaev16081111m
Scaffold9994:4537960..4537984 21/25 Antisense off-target Xelaev16081360m
Publications
First: Geminin deficiency causes a Chk1-dependent G2 arrest in Xenopus., Mol Biol Cell 2002  
Most recent: Geminin is required for zygotic gene expression at the Xenopus mid-blastula transition., PLoS One 2012                          
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.2


Major funding for Xenbase is provided by grant P41 HD064556