Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249641

Morpholino Name: gnas MO1
Synonyms: Gnas-MO
Target mRNA: gnas

Morpholino Type: uncategorized morpholino
Sequence: 5' AGACACCCCATGGTCCGTGTGGGCT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25 25/25 25/25
genomic

MO
5' CGCCCGCCCGGACCATGGGGTGTCT 3' |||| | ||||||||||||||||| 3' TCGGGTGTGCCTGGTACCCCACAGA 5' 5' AGCCCACACGGACCATGGGGTGTCT 3' ||||||||||||||||||||||||| 3' TCGGGTGTGCCTGGTACCCCACAGA 5' 5' AGCCCACACGGACCATGGGGTGTCT 3' ||||||||||||||||||||||||| 3' TCGGGTGTGCCTGGTACCCCACAGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr9_10S:15160898..15160922 25/25 Antisense target gnas.S
chr9_10L:16478383..16478407 25/25 Antisense target gnas.L
tropicalis 10.0 Chr10:2999975..2999999 22/25 Antisense target gnas
Chr4:93784896..93784920 22/25 Sense off-target cyp4b1
Publications
First: Regulation of G-protein signaling via Gnas is required to regulate proximal tubular growth in the Xenopus pronephros., Dev Biol 2013                          
Most recent: Polycystin 1 loss of function is directly linked to an imbalance in G-protein signaling in the kidney., Development 2018                          
View All Papers