Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249644

Morpholino Name: gnl3 MO1
Synonyms: nucleostemin Xns MO
mRNA Target: gnl3

Morpholino Type: uncategorized morpholino
Sequence:
5' TCCTTAGCTTCGGACGTTTCATGGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
Publications
First: Evolutionarily conserved role of nucleostemin: controlling proliferation of stem/progenitor cells during early vertebrate development., Mol Cell Biol 2006    
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556