Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249657

Morpholino Name: gsc MO1
Synonyms: Gsc MO, Gsc-MO, goosecoid MO
mRNA Target: gsc

Morpholino Type: uncategorized morpholino
Sequence:
5' GCTGAACATGCCAGAAGGCATCACC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' GGTGATGCCTTCTGGCATGTTCAGC 3' ||||||||||||||||||||||||| 3' CCACTACGGAAGACCGTACAAGTCG 5' 5' GGTGATGCCTTCTGGCATGTTCAGC 3' ||||||||||||||||||||||||| 3' CCACTACGGAAGACCGTACAAGTCG 5' 5' GGTGATGCCTTCTGGCATGTTCAGC 3' ||||||||||||||||||||||||| 3' CCACTACGGAAGACCGTACAAGTCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8L:65915805..65915829 25/25 Antisense target gsc.L
chr8S:19970445..19970469 25/25 Antisense target gsc.S
tropicalis 10.0 Chr8:88449044..88449068 25/25 Antisense target gsc
Chr1:131049891..131049915 22/25 unknown
Chr1:39010106..39010130 22/25 Antisense off-target fryl
Chr9:49135207..49135231 21/25 Antisense off-target pikfyve
Publications
First: The opposing homeobox genes Goosecoid and Vent1/2 self-regulate Xenopus patterning., EMBO J 2007                
Most recent: Morpholinos Do Not Elicit an Innate Immune Response during Early Xenopus Embryogenesis., Dev Cell 2019          
View All Papers