Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249658

Morpholino Name: gsk3b MO1
Synonyms: GSK3beta
Target mRNA: gsk3b

Morpholino Type: uncategorized morpholino
Sequence: 5' CTCACCTCCTTCTCTTCTAGATCAA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TTGATCTAGAAGAGAAGGAGGTGAG 3' ||||||||||||||||||||||||| 3' AACTAGATCTTCTCTTCCTCCACTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr2L:1343013..1343037 25/25 Antisense target gsk3b.L
chr2S:28677838..28677862 25/25 Antisense off-target LOC779056 [provisional:gsk3b]
chr3L:52112953..52112977 22/25 Sense off-target lgr5.L
chr3S:86351276..86351300 22/25 Sense off-target lgr5.S
chr6S:120759056..120759080 21/25 Antisense off-target Xelaev18034021m
chr7L:63994195..63994219 21/25 Sense off-target adamts8.L
chr2S:29347963..29347987 21/25 Sense off-target LOC108709310 [provisional:rbak-rbakdn]
chr3L:4496256..4496280 21/25 Antisense off-target LOC108710183
chr3L:9640495..9640519 21/25 Antisense off-target LOC108710791 [provisional:fat2]
Scaffold79471:173..197 21/25 unknown
chr9_10S:29221457..29221481 21/25 unknown
tropicalis 10.0 Chr3:59782355..59782379 22/25 Sense off-target lgr5
Chr4:114077645..114077669 21/25 Sense off-target f8a1
Chr4:114077645..114077669 21/25 Antisense off-target emp1
Chr8:84417147..84417171 21/25 unknown
Publications
First: Xenopus XsalF: anterior neuroectodermal specification by attenuating cellular responsiveness to Wnt signaling., Dev Cell 2004              
Most recent:
View All Papers