Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249659

Morpholino Name: gsx1 MO1
Synonyms: Gsh1-AMO
Target mRNA: gsx1

Morpholino Type: uncategorized morpholino
Sequence: 5' CCACTAGGAAGGATCGAGGCATGAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 23/25
genomic

MO
5' CTCATGCCTCGATCCTTCCTAGTGG 3' ||||||||||||||||||||||||| 3' GAGTACGGAGCTAGGAAGGATCACC 5' 5' CTCATGCCTCGCTCCTTCCTAGTGG 3' ||||||||||| ||||||||||||| 3' GAGTACGGAGCTAGGAAGGATCACC 5' 5' CTCATGCCTCACTCCTTCCTAGTGG 3' |||||||||| ||||||||||||| 3' GAGTACGGAGCTAGGAAGGATCACC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr2L:158837703..158837727 24/25 Antisense target gsx1.L
chr2S:138378613..138378637 23/25 Antisense target gsx1.S
tropicalis 10.0 Chr2:155219650..155219674 25/25 Antisense target gsx1
Publications
First: Gsx transcription factors repress Iroquois gene expression., Dev Dyn 2011          
Most recent:
View All Papers