Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249660

Morpholino Name: gsx2 MO1
Synonyms: Gsh2, Gsh2-AMO
Target mRNA: gsx2

Morpholino Type: uncategorized morpholino
Sequence: 5' AGCTCAGCAGTCAGACAGCTCCTTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GAAGGAGCTGTCTGACTGCTGAGCT 3' ||||||||||||||||||||||||| 3' CTTCCTCGACAGACTGACGACTCGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8S:35615095..35615119 21/25 Sense off-target plxnb3.S
chr3L:92141572..92141596 21/25 unknown
tropicalis 10.0 Chr1:39955798..39955822 25/25 Antisense target gsx2
Publications
First: Conserved and novel roles for the Gsh2 transcription factor in primary neurogenesis., Development 2010          
Most recent: Gsx transcription factors repress Iroquois gene expression., Dev Dyn 2011          
View All Papers