Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249661

Morpholino Name: gsx2 MO2
Synonyms: Gsh2
Target mRNA: gsx2

Morpholino Type: uncategorized morpholino
Sequence: 5' CATAAAAAGACCTAGACATTGCCGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25 24/25
genomic

MO
5' GCGGCAATGTCTAGGTCTTTTTATG 3' ||||||||||||||||||||||||| 3' CGCCGTTACAGATCCAGAAAAATAC 5' 5' GCTACAATGTCTAGGTCTTTTTATG 3' || ||||||||||||||||||||| 3' CGCCGTTACAGATCCAGAAAAATAC 5' 5' GCTGCAATGTCTAGGTCTTTTTATG 3' || |||||||||||||||||||||| 3' CGCCGTTACAGATCCAGAAAAATAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1S:29007060..29007084 24/25 Antisense target gsx2.S
chr1L:32455358..32455382 23/25 Antisense target gsx2.L
tropicalis 10.0 Chr1:39955823..39955847 25/25 Antisense target gsx2
Publications
First: Conserved and novel roles for the Gsh2 transcription factor in primary neurogenesis., Development 2010          
Most recent:
View All Papers