Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249664

Morpholino Name: h3f3a MO1
Synonyms: H3 MO1
mRNA Target: h3f3a

Morpholino Type:
Sequence:
5' TGTACGGGCCATTTCCCTTTAATCG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CGATTAAAGGGAAATGGCCCGTACA 3' ||||||||||||||||||||||||| 3' GCTAATTTCCCTTTACCGGGCATGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold27161:6723792-6723816 25/25 Antisense target h3f3a.L
Scaffold102974:5030303-5030327 24/25 Antisense off-target Xelaev16000637m
Scaffold148881:99897-99921 21/25 unknown
tropicalis 7.1 scaffold_5:117974423-117974447 23/25 Antisense off-target hist1h3g
Publications
First: Optimal histone H3 to linker histone H1 chromatin ratio is vital for mesodermal competence in Xenopus. [Development 2013]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556