Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249665

Morpholino Name: h3f3a MO2
Synonyms: H3 MO2
mRNA Target: h3f3a

Morpholino Type:
Sequence:
5' GCGGTCTGCTTGGTACGAGCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 21/23
genomic

MO
5' ATGGCCCGTACAAAGCAGACCGC 3' ||||| ||||| ||||||||||| 3' TACCGAGCATGGTTCGTCTGGCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold107276:28..50 23/23 unknown
Scaffold11418:287763..287785 23/23 Antisense off-target Xelaev16004011m
Scaffold21594:291047..291069 23/23 Antisense off-target Xelaev16027631m
Scaffold368900:522..544 23/23 Antisense off-target Xelaev16048008m
Scaffold45548:13305..13327 23/23 Antisense off-target Xelaev16055136m
Scaffold88026:576..598 23/23 unknown
Scaffold111824:6160776..6160798 22/23 Antisense off-target hist1h3g.L
Scaffold197913:671658..671680 22/23 unknown
Scaffold266130:979..1001 22/23 Antisense off-target Xelaev16035772m
Scaffold311541:49..71 22/23 unknown
Scaffold360305:25..47 22/23 unknown
Scaffold440:28..50 22/23 unknown
Scaffold73900:152..174 22/23 unknown
Scaffold74488:1296175..1296197 22/23 Antisense off-target Xelaev16071281m
Scaffold98376:506..528 22/23 Antisense off-target Xelaev16080451m
Scaffold102974:5030292..5030314 21/23 Antisense off-target Xelaev16000637m
Scaffold182405:902..924 21/23 unknown
Scaffold23403:10393801..10393823 21/23 Antisense off-target hist2h3d.L
Scaffold256136:346731..346753 21/23 Antisense off-target Xelaev16034592m
Scaffold27161:6723805..6723827 21/23 Antisense target h3f3a.L
Scaffold276800:12681..12703 21/23 Antisense off-target Xelaev16038015m
Scaffold51769:1..22 21/23 unknown
Scaffold71264:973513..973535 21/23 Antisense off-target Xelaev16069862m
Scaffold9994:9618828..9618850 21/23 Antisense off-target Xelaev16081471m
Scaffold147336:102942..102964 20/23 Antisense off-target Xelaev16014016m
tropicalis 7.1 scaffold_6:141909130..141909152 23/23 unknown
scaffold_2:102002777..102002799 22/23 unknown
scaffold_2:102009653..102009675 22/23 unknown
scaffold_2:102085746..102085768 22/23 unknown
scaffold_302:39759..39781 22/23 unknown
scaffold_302:9600..9622 22/23 unknown
scaffold_312:1602..1624 22/23 unknown
scaffold_312:4910..4932 22/23 unknown
scaffold_312:89901..89923 22/23 unknown
scaffold_38:302408..302430 22/23 unknown
scaffold_38:457385..457407 22/23 unknown
scaffold_38:699771..699793 22/23 unknown
scaffold_4:81651790..81651812 22/23 unknown
scaffold_4:81672021..81672043 22/23 unknown
scaffold_4:81681504..81681526 22/23 unknown
scaffold_4:81738141..81738163 22/23 unknown
scaffold_4:81789791..81789813 22/23 unknown
scaffold_4:81848593..81848615 22/23 unknown
scaffold_4:81885956..81885978 22/23 unknown
scaffold_4:81895415..81895437 22/23 unknown
scaffold_4:81971866..81971888 22/23 unknown
scaffold_4:81976709..81976731 22/23 unknown
scaffold_4:82035486..82035508 22/23 unknown
scaffold_4:82192499..82192521 22/23 unknown
scaffold_4:82205214..82205236 22/23 unknown
scaffold_4:82214243..82214265 22/23 unknown
scaffold_4:82498338..82498360 22/23 unknown
scaffold_4:82499632..82499654 22/23 unknown
scaffold_44:190502..190524 22/23 unknown
scaffold_44:673603..673625 22/23 unknown
scaffold_6:141912389..141912411 22/23 unknown
scaffold_6:141916324..141916346 22/23 unknown
scaffold_75:232476..232498 22/23 unknown
scaffold_75:287668..287690 22/23 unknown
scaffold_75:294227..294249 22/23 unknown
scaffold_8c:3065969..3065991 22/23 unknown
scaffold_8c:3127971..3127993 22/23 unknown
scaffold_4:81770888..81770910 21/23 unknown
scaffold_4:81778229..81778251 21/23 unknown
scaffold_5:117974436..117974458 21/23 Antisense off-target hist1h3g
Publications
First: Optimal histone H3 to linker histone H1 chromatin ratio is vital for mesodermal competence in Xenopus. [Development 2013]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556