Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249666

Morpholino Name: h3f3a MO3
Synonyms: H3.3
mRNA Target: h3f3a

Morpholino Type:
Sequence:
5' GGTCTGCTTTGTACGGGCCATTTCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GGAAATGGCCCGTACAAAGCAGACC 3' ||||||||||||||||||||||||| 3' CCTTTACCGGGCATGTTTCGTCTGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold27161:6723801..6723825 25/25 Antisense target h3f3a.L
Scaffold102974:5030294..5030318 23/25 Antisense off-target Xelaev16000637m
Scaffold23403:10393797..10393821 21/25 Antisense off-target hist2h3d.L
Scaffold4321:2839778..2839802 21/25 Sense off-target Xelaev16052962m
Scaffold440:30..54 21/25 unknown
Scaffold73900:148..172 21/25 unknown
Scaffold74488:1296171..1296195 21/25 Antisense off-target Xelaev16071281m
Scaffold9994:9618830..9618854 21/25 Antisense off-target Xelaev16081471m
tropicalis 7.1 scaffold_5:117974432..117974456 23/25 Antisense off-target hist1h3g
scaffold_44:190504..190528 22/25 unknown
scaffold_44:673599..673623 22/25 unknown
scaffold_10:4294569..4294593 21/25 Antisense off-target h3f3b
scaffold_109:147431..147455 21/25 unknown
scaffold_109:69462..69486 21/25 unknown
scaffold_109:87989..88013 21/25 unknown
scaffold_2:102002779..102002803 21/25 unknown
scaffold_2:102009655..102009679 21/25 unknown
scaffold_2:102085748..102085772 21/25 unknown
scaffold_302:39761..39785 21/25 unknown
scaffold_302:9602..9626 21/25 unknown
scaffold_312:1604..1628 21/25 unknown
scaffold_312:4912..4936 21/25 unknown
scaffold_312:89903..89927 21/25 unknown
scaffold_38:302404..302428 21/25 unknown
scaffold_38:457387..457411 21/25 unknown
scaffold_38:699767..699791 21/25 unknown
scaffold_4:81651786..81651810 21/25 unknown
scaffold_4:81672017..81672041 21/25 unknown
scaffold_4:81681500..81681524 21/25 unknown
scaffold_4:81738137..81738161 21/25 unknown
scaffold_4:81789787..81789811 21/25 unknown
scaffold_4:81848595..81848619 21/25 unknown
scaffold_4:81885952..81885976 21/25 unknown
scaffold_4:81895411..81895435 21/25 unknown
scaffold_4:81971862..81971886 21/25 unknown
scaffold_4:81976705..81976729 21/25 unknown
scaffold_4:82035488..82035512 21/25 unknown
scaffold_4:82192495..82192519 21/25 unknown
scaffold_4:82205210..82205234 21/25 unknown
scaffold_4:82214239..82214263 21/25 unknown
scaffold_4:82498334..82498358 21/25 unknown
scaffold_4:82499634..82499658 21/25 unknown
scaffold_6:141912385..141912409 21/25 unknown
scaffold_75:232478..232502 21/25 unknown
scaffold_75:287664..287688 21/25 unknown
scaffold_75:294229..294253 21/25 unknown
scaffold_8:50635391..50635415 21/25 Antisense off-target h3f3c
scaffold_8:50777604..50777628 21/25 Antisense off-target hist2h3d
scaffold_8:50785602..50785626 21/25 unknown
scaffold_8:50819363..50819387 21/25 unknown
scaffold_8:50844080..50844104 21/25 unknown
scaffold_8:50916367..50916391 21/25 unknown
scaffold_8:50934790..50934814 21/25 Antisense off-target hist2h3c
scaffold_8c:3065965..3065989 21/25 unknown
scaffold_8c:3127973..3127997 21/25 unknown
Publications
First: A developmental requirement for HIRA-dependent H3.3 deposition revealed at gastrulation in Xenopus. [Cell Rep 2012]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556