Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249667

Morpholino Name: hand2 MO1
Synonyms: Hand2 MO
mRNA Target: hand2

Morpholino Type:
Sequence:
5' CCCCAACCAGACTCATCTCAGCTAC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25 25/25 24/25
genomic

MO
5' CCAGCTGACATGAGTCTGGTTGGGG 3' |||||| |||||||||||||||| 3' CATCGACTCTACTCAGACCAACCCC 5' 5' GTAGCTGAGATGAGTCTGGTTGGGG 3' ||||||||||||||||||||||||| 3' CATCGACTCTACTCAGACCAACCCC 5' 5' GTAGCTGACATGAGTCTGGTTGGGG 3' |||||||| |||||||||||||||| 3' CATCGACTCTACTCAGACCAACCCC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold14692:7725192-7725216 25/25 Antisense target hand2.L
Scaffold205629:755478-755502 24/25 Antisense target hand2.S
Scaffold256647:1195836-1195860 21/25 Sense off-target Xelaev16034785m
tropicalis 7.1 scaffold_1:175362656-175362680 22/25 Antisense target hand2
Publications
First: Xenopus zinc finger transcription factor IA1 (Insm1) expression marks anteroventral noradrenergic neuron progenitors in Xenopus embryos. [Dev Dyn 2008]
Most recent: Ascl1 as a novel player in the Ptf1a transcriptional network for GABAergic cell specification in the retina. [PLoS One 2014]
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556