Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249667

Morpholino Name: hand2 MO1
Synonyms: Hand2 MO
Target mRNA: hand2

Morpholino Type: uncategorized morpholino
Sequence: 5' CCCCAACCAGACTCATCTCAGCTAC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25 25/25 24/25
genomic

MO
5' CCAGCTGACATGAGTCTGGTTGGGG 3' |||||| |||||||||||||||| 3' CATCGACTCTACTCAGACCAACCCC 5' 5' GTAGCTGAGATGAGTCTGGTTGGGG 3' ||||||||||||||||||||||||| 3' CATCGACTCTACTCAGACCAACCCC 5' 5' GTAGCTGACATGAGTCTGGTTGGGG 3' |||||||| |||||||||||||||| 3' CATCGACTCTACTCAGACCAACCCC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr1L:42174324..42174348 25/25 Antisense target hand2.L
chr1S:37503147..37503171 24/25 Antisense target hand2.S
chr3S:6459733..6459757 21/25 Sense off-target tspan11.S
chr3S:6459787..6459811 21/25 Sense off-target tspan11.S
chr3S:6459805..6459829 21/25 Sense off-target tspan11.S
chr3S:6459823..6459847 21/25 Sense off-target tspan11.S
tropicalis 10.0 Chr1:48657388..48657412 22/25 Antisense target hand2
Publications
First: Xenopus zinc finger transcription factor IA1 (Insm1) expression marks anteroventral noradrenergic neuron progenitors in Xenopus embryos., Dev Dyn 2008            
Most recent: Ascl1 as a novel player in the Ptf1a transcriptional network for GABAergic cell specification in the retina., PLoS One 2014                          
View All Papers