Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249668

Morpholino Name: hapln3 MO1
Synonyms: XHAPLN3-MO
mRNA Target: hapln3

Morpholino Type:
Sequence:
5' ATCACAGCAAATTCGGCAAGCATTG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CAATGCTTGCCGAATTTGCTGTGAT 3' ||||||||||||||||||||||||| 3' GTTACGAACGGCTTAAACGACACTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold9266:8955156-8955180 25/25 Antisense target hapln3.L
Scaffold113816:1085324-1085348 21/25 unknown
Scaffold35469:211290-211314 21/25 unknown
Publications
First: XHAPLN3 plays a key role in cardiogenesis by maintaining the hyaluronan matrix around heart anlage. [Dev Biol 2008]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556