Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249671

Morpholino Name: has2 MO1
Synonyms: Has2 MO 1, XHas2-Mo1
mRNA Target: has2

Morpholino Type: uncategorized morpholino
Sequence:
5' GTTATTGCCTTGGTCCTGTGGTCAC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' GTGACCATAGGACCAAGGCAATAAC 3' ||||||| ||||||||||||||||| 3' CACTGGTGTCCTGGTTCCGTTATTG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold221708:44..68 21/25 unknown
Scaffold29621:795785..795809 21/25 Antisense off-target dsc3.S
Scaffold311581:71971..71995 21/25 unknown
tropicalis 7.1 scaffold_6:9448308..9448332 24/25 Antisense target has2
scaffold_5:99019177..99019201 21/25 unknown
Publications
First: XHas2 activity is required during somitogenesis and precursor cell migration in Xenopus development., Development 2006                          
Most recent: Hyaluronan is required for cranial neural crest cells migration and craniofacial development., Dev Dyn 2012                
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556