Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249672

Morpholino Name: has2 MO2
Synonyms: Has2 MO 2, XHas2-Mo2, Xhas2 MO2
mRNA Target: has2

Morpholino Type: uncategorized morpholino
Sequence:
5' TGCATATAAACCGTTCACAGTGCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' ATGCACTGTGAACGGTTTATATGCA 3' ||||||||||||||||||||||||| 3' TACGTGACACTTGCCAAATATACGT 5' 5' ATGCACTGTGAACGGTTTATATGCA 3' ||||||||||||||||||||||||| 3' TACGTGACACTTGCCAAATATACGT 5' 5' ATGCACTGTGAACGGTTTATATGCA 3' ||||||||||||||||||||||||| 3' TACGTGACACTTGCCAAATATACGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6L:141003235..141003259 25/25 Antisense target has2.L
chr6S:116626511..116626535 25/25 Antisense target has2.S
tropicalis 10.0 Chr6:139329519..139329543 25/25 Antisense target has2
Chr4:141890826..141890850 21/25 Antisense off-target lmod3
Publications
First: XHas2 activity is required during somitogenesis and precursor cell migration in Xenopus development., Development 2006                          
Most recent: Hyaluronan is required for cranial neural crest cells migration and craniofacial development., Dev Dyn 2012                
View All Papers