Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249672

Morpholino Name: has2 MO2
Synonyms: Has2 MO 2, XHas2-Mo2, Xhas2 MO2
mRNA Target: has2

Morpholino Type: uncategorized morpholino
Sequence:
5' TGCATATAAACCGTTCACAGTGCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATGCACTGTGAACGGTTTATATGCA 3' ||||||||||||||||||||||||| 3' TACGTGACACTTGCCAAATATACGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold220448:961438..961462 25/25 Antisense off-target Xelaev16028593m
Scaffold250769:671782..671806 25/25 Antisense off-target Xelaev16033323m
tropicalis 7.1 scaffold_6:9441615..9441639 25/25 Antisense target has2
scaffold_4:130804561..130804585 21/25 Antisense off-target lmod3
Publications
First: XHas2 activity is required during somitogenesis and precursor cell migration in Xenopus development., Development 2006                          
Most recent: Hyaluronan is required for cranial neural crest cells migration and craniofacial development., Dev Dyn 2012                
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556